You are here: pDream2.1/LIC Kit

Note:

This product has been discontinued!

pDream2.1/LIC Kit

Cat. No.	Size	Price
Full Name	pDream2.1/LIC Kit

GenScript's pDream2.1/LIC vector is a protein expression vector designed for both efficient cloning and high-level expression of any target gene. The gene of interest can be efficiently cloned into the vector using the ligation-independent cloning (LIC) method and can be expressed in any one of the three major protein expression systems without any further subcloning: bacteria, insect cells, and mammalian cells. The GenScript LIC cloning kit is included in the pDream2.1/LIC vector package.

LIC Kit Components

Predigested pDream2.1/LIC	1 µg	20 µl
T4 DNA Polymerase	20 U	20 ul
5X T4 DNA Polymerase Buffer	5X	100 ul
cGFP Control Insert	5 ng/ul	10 ul
dATP	25 mM	50 ul
EDTA	25 mM	50 ul

Related Products

SD0220: Positive control vector.

A00013: Anti-flag antibody

Z01003: Enterokinase

L00206: GST resin

Storage Buffer and Concentration: - 20°C

Download Protocol: TM0180

Forward Sequencing Primer:
DA0009: T7 (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0008: SP6 (TACGATTTAGGTGACACTATAG)

Detailed Map:
T7: 1609-1625
P10 Promoter: 1651-1764
ORF603: 45-1011
ORF1629: 4918-5424
CMV Promoter: 1020-1602
SV40 Promoter: 2997-3342
Neomycin: 3383-4177
pUC ori: 5602-6233
Ampicillin: 6234-7094

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Ali Naderi, Andrew E. Teschendorff, Juergen Beigel, Massimiliano Cariati, Ian O. Ellis, James D. Brenton and Carlos Caldas. BEX2 Is Overexpressed in a Subset of Primary Breast Cancers and Mediates Nerve Growth Factor/Nuclear Factor-B Inhibition of Apoptosis in Breast Cancer Cell Lines. Cancer Research. Jul 2007; 67(14): 6725-6736

DATASHEET:  20060322221725  (PDF)
MSDS:  20051003104721  (PDF)