You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNA-U6.1/Hygro

pRNA-U6.1/Hygro

Cat. No.	Size	Price
SD1202-10 ug	10 ug	$ 225.00
Full Name	pRNA-U6.1/Hygro

Description: pRNA-U6.1/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene that can be used for establishing stable cell lines. It uses a U6 promoter for siRNA expression.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 78-101
U6 Promoter: 4998-77
SV40 Promoter: 850-1195
Hygromycin: 1218-2243
pUC ori: 2913-3553
Ampicillin: 3701-4561

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Michael J. MacDonald, Andrew D. Smith, III, Noaman M. Hasan, Grzegorz Sabat, and Leonard A. Fahien. Feasibility of pathways for transfer of acyl groups from mitochondria to the cytosol to form short chain acyl-CoAs in the pancreatic beta cell. J. Biol. Chem. Aug 2007;

• Kuwata H, Fujimoto C, Yoda E, Shimbara S, Nakatani Y, Hara S, Murakami M, Kudo I. A novel role of group VIB calcium-independent phospholipase A2 (iPLA2gamma ) in the inducible expression of group IIA secretory phospholipase A2 in rat fibroblastic cells. J Biol Chem. May 2007; 282(28): 20124-20132

• Zhang Y, Zhang B. D4-GDI, a Rho GTPase Regulator, Promotes Breast Cancer Cell Invasiveness. Cancer Res. Jun 2006; 66(11): 5592-5598

• Jen-Liang Su, Ching-Yao Yang, Jin-Yuan Shih, Lin-Hung Wei, Chang-Yao Hsieh, Yung-Ming Jeng, Ming-Yang Wang, Pan-Chyr Yang, and Min-Liang Kuo. Knockdown of Contactin-1 Expression Suppresses Invasion and Metastasis of Lung Adenocarcinoma. Cancer Res. Mar 2006; 66(5): 2553-2561

• Atsuko Yoneda, Hinke A.B. Multhaupt, and John R. Couchman. The Rho kinases I and II regulate different aspects of myosin II activity. J. Cell. Biol. Aug 2005; 170(3): 443-453

• Hiroshi Kuwata, Takuya Nonaka, Makoto Murakami, and Ichiro Kudo. Search of factors that intermediate cytokine-induced group IIA phospholipase A₂ expression through the cytosolic phospholipase A₂- and 12/15-lipoxygenase-dependent pathway. J. Biol. Chem. May 2005; 280(27): 25830-25839

• Xiu Qin Xu, B. Starling Emerald, Eyleen L. L Goh, Nagarajan Kannan, Lance D. Miller, Peter D. Gluckman, Edison T. Liu, and Peter E. Lobie. Gene expression profiling to identify oncogenic determinants of autocrine human growth hormone (hGH) in human mammary carcinoma. J. Biol. Chem. Jun 2005; 280(25): 23987-24003

• Makoto Murakami, Seiko Masuda, Kaori Ueda-Semmyo, Emiko Yoda, Hiroshi Kuwata, Yasukazu Takanezawa, Junken Aoki, Hiroyuki Arai, Hideki Sumimoto, Yukio Ishikawa, Toshiharu Ishii, Yoshihito Nakatani, and Ichiro Kudo. Group VIB Ca₂₊-independent phospholipase A₂ γ promotes cellular membrane hydrolysis and prostaglandin production in a manner distinct from other intracellular phospholipases A₂. J. Biol. Chem. Apr 2005; 280(14): 14028-14041

• Daisuke Kamei, Kiyofumi Yamakawa, Yui Takegoshi, Maya Mikami-Nakanishi, Yoshihito Nakatani, Sachiko Oh-ishi, Hidekazu Yasui, Yoshiaki Azuma, Noriyasu Hirasawa, Kazuo Ohuchi, Hiroshi Kawaguchi, Yukio Ishikawa, Toshiharu Ishii, Satoshi Uematsu, Shizuo Akira, Makoto Murakami, and Ichiro Kudo. Reduced Pain Hypersensitivity and Inflammation in Mice Lacking Microsomal Prostaglandin E Synthase-1. J. Biol. Chem. Aug 2004; 279(32): 33684-33695

• Suzanne Benjannet, David Rhainds, Rachid Essalmani, Janice Mayne, Louise Wickham, Weijun Jin, Marie-Claude Asselin, Josée Hamelin, Mathilde Varret, Delphine Allard, Mélanie Trillard, Marianne Abifadel, Angie Tebon, Alan D Attie, Daniel J Rader, Catherine Boileau, Louise Brissette, Michel Chrétien, Annik Prat, and Nabil G Seidah. NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the LDLR and LDL-cholesterol. J. Biol. Chem. Nov 2004; 279(47): 48865-48875

1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.