pRNA-H1.1/Neo
| Cat. No. | Size | Price |
|---|---|---|
SD1203-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-H1.1/Neo | |
pRNA-H1.1/Neo
Description
pRNA-H1.1/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene which can be used for establishing stable cell line. It uses H1 promoter for siRNA expression.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 4700-4723
H1 Promoter: 4600-4699
SV40 Promoter: 647-992
Neomycin: 1033-1827
pUC ori: 2541-3181
Ampicillin: 3329-4189
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Huang Y, Kang BN, Tian J, Liu Y, Luo HR, Hester L, Snyder SH. The cationic amino acid transporters CAT1 and CAT3 mediate NMDA receptor activation-dependent changes in elaboration of neuronal processes via the mammalian target of rapamycin mTOR pathway. J. Neurosci. Jan 2007; 27(3): 449-458
- Asish K. Ghsoh, Robert Steele, and Ratna B. Ray. Knockdown of MBP-1 in human prostate cancer cells delays cell cycle progression. J. Biol. Chem. Aug 2006; 281(33): 23652-23657
- Livigni A, Scorziello A, Agnese S, Adornetto A, Carlucci A, Garbi C, Castaldo I, Annunziato L, Avvedimento EV, Feliciello A. Mitochondrial AKAP121 links cAMP and src signalling to oxidative metabolism. Mol.Biol.Cell. Jan 2006; 17(1): 263-271
- Roberta Fiume, Irene Faenza, Alessandro Matteucci, Annalisa Astolfi, Marco Vitale, Alberto Maria Martelli, and Lucio Cocco. Nuclear PLCbeta 1 affects CD24 expression in murine erythroleukemia cells. J. Biol. Chem. Jun 2005; 280(25): 24221-24226
- Asish K. Ghosh, Robert Steele, and Ratna B. Ray. c-myc Promoter-binding Protein 1 (MBP-1) Regulates Prostate Cancer Cell Growth by Inhibiting MAPK Pathway. J. Biol. Chem. Apr 2005; 280(14): 14325-14330
- Orlando Piro and George J. Broze, Jr. Role for the Kunitz-3 Domain of Tissue Factor Pathway Inhibitor-α in Cell Surface Binding. Circulation. Dec 2004; 110(23): 3567-3572
- Asish K. Ghosh, Robert Steele, and Ratna B. Ray. MBP-1 regulates prostate cancer cell growth by inhibiting MAP kinase pathway. J. Biol. Chem. Apr 2005; 280(14): 14325-14330








