pRNA-H1.1/Hygro
| Cat. No. | Size | Price |
|---|---|---|
SD1204-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-H1.1/Hygro | |
Description: pRNA-H1.1/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a Hygromycin resistance gene which can be used for establishing stable cell line. It uses H1 promoter for siRNA expression.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 4819-4842
H1 Promoter: 4719-4818
SV40 Promoter: 597-942
Hygromycin: 965-1990
pUC ori: 2660-3300
Ampicillin: 3448-4308
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Privette LM, González ME, Ding L, Kleer CG, Petty EM. Altered Expression of the Early Mitotic Checkpoint Protein, CHFR, in Breast Cancers: Implications for Tumor Suppression. Cancer Res. Jun 2007; 67: 6064-6074
PRODUCTINFO: 20051023212708 (PDF)
![]() |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |









