You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors »  pRNA-U6.1/Shuttle

pRNA-U6.1/Shuttle

Cat. No.	Size	Price
SD1205-10 ug	10 ug	$ 225.00
Full Name	pRNA-U6.1/Shuttle

Description: pRNA-U6.1/Shuttle is a GenScript adenoviral siRNA shuttle vector, which is compatible with Clontech Adeno-X^TM Expression System 1. It uses U6 promoter for siRNA expression.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0165

Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 78-101
U6 Promoter: 4897-77
SV40 Promoter: 892-1237
Neomycin: 1278-2072
pUC ori: 2786-3426
Ampicillin: 3574-4434

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Kanekura K, Nishimoto I, Aiso S, Matsuoka M. Characterization of amyotrophic lateral sclerosis-linked pro56ser mutation of vesicle-associated membrane protein-associated protein B (VAPB/ALS8). J. Biol. Chem. Oct 2006; 281(40): 30223-30233

• Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, and Masaaki Matsuoka. A Rac1/ phosphatidylinositol-3 kinase /Akt3 anti-apoptotic pathway, triggered by alsinLF, the product of the ALS2 gene, antagonizes Cu/Zn-superoxide dismutase (SOD1) mutant-induced motoneuronal cell death. J. Biol. Chem. Feb 2005; 280(6): 4532-4543