pRNA-U6.1/Zeo
| Cat. No. | Size | Price |
|---|---|---|
SD1207-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-U6.1/Zeo | |
Description: pRNA-U6.1/Zeo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a zeomycin resistance gene that can be used for establishing stable cell line. It uses U6 promoter for siRNA expression.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 628-651
U6 Promoter: 301-627
SV40 Promoter: 1254-1600
Zeomycin: 1688-2062
pUC ori: 2732-3375
Ampicillin: 3523-4383
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051023214201 (PDF)
![]() |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |









