pRNA-H1.1/Adeno

Cat. No.SizePrice
SD1209-10 ug
10 ug $ 225.00
Full NamepRNA-H1.1/Adeno

Description: GenScript pRNA-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An siRNA insert can be cloned into the polylinker region under H1 promoter control. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication.




Storage Buffer and Concentration: - 20ºC

Download Protocol: tm0165

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)

Detailed Map:
pBR322 origin: 4028-4695
Kanamycin: 5504-6295
Polylinker: 506-529
H1 Promoter: 406-505

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051023215907  (PDF)