You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors »  pRNA-H1.1/Adeno

pRNA-H1.1/Adeno

Cat. No.	Size	Price
SD1209-10 ug	10 ug	$ 225.00
Full Name	pRNA-H1.1/Adeno

Description: GenScript pRNA-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An siRNA insert can be cloned into the polylinker region under H1 promoter control. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication.

Storage Buffer and Concentration: - 20ºC

Download Protocol: tm0165

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)

Detailed Map:
pBR322 origin: 4028-4695
Kanamycin: 5504-6295
Polylinker: 506-529
H1 Promoter: 406-505

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051023215907  (PDF)

1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.