pRNAT-U6.1/Neo
| Cat. No. | Size | Price |
|---|---|---|
SD1211-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-U6.1/Neo | |
Description: pRNAT-U6.1/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker, which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses U6 promoter for siRNA expression.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 78-101
U6 Promoter: 6131-77
CMV Promoter: 140-727
cGFP: 745-1463
SV40 Promoter: 2152-2497
Neomycin: 2538-3332
pUC ori: 4046-4686
Ampicillin: 4834-5694
Vector Sequence and Restriction Enzyme Map
* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
Publications used this GenScript product:
- Jin-Wu Tsai, K Helen Bremner ,Richard B Vallee Dual subcellular roles for LIS1 and dynein in radial neuronal migration in live brain tissue Nat. Neurosci. Aug 2007; 10(8): 970-979
- Jin H. Song, Margaret C.L. Tse, Anita Bellail, Surasak Phuphanich, Fadlo Khuri, Norman M. Kneteman and Chunhai Hao. Lipid Rafts and Nonrafts Mediate Tumor Necrosis Factor–Related Apoptosis-Inducing Ligand–Induced Apoptotic and Nonapoptotic Signals in Non–Small Cell Lung Carcinoma Cells. Cancer Research. Jul 2007; 67(14): 6946-6955
- Okaya A, Kitanaka J, Kitanaka N, Satake M, Kim Y, Terada K, Sugiyama T, Takemura M, Fujimoto J, Terada N, Miyajima A, Tsujimura T. Oncostatin M inhibits proliferation of rat oval cells, OC15-5, inducing differentiation into hepatocytes. Am. J. Pathol. Mar 2005; 166(3): 709-719
- Sheng Wang, Baohua Zhang, and Douglas V Faller. BRG1/BRM and prohibitin are required for growth suppression by estrogen antagonists. EMBO. J. Jun 2004; 23(11): 2293-2303
- Toshio Hamatani, Geppino Falco, Mark G. Carter, Hidenori Akutsu, Carole A. Stagg, Alexei A. Sharov, Dawood B. Dudekula, Vincent VanBuren, and Minoru S.H. Ko. Age-associated alteration of gene expression patterns in mouse oocytes. Hum. Mol. Genet. Oct 2004; 13(19): 2263-2278
- Cheikh I. Seye, Ningpu Yu, Fernando A. Gonzalez, Laurie Erb, and Gary A. Weisman. The P2Y2 Nucleotide Receptor Mediates Vascular Cell Adhesion Molecule-1 Expression through Interaction with VEGF Receptor-2 (KDR/Flk-1). J. Biol. Chem. Aug 2004; 279(34): 35679-35686
PRODUCTINFO: 20051023220029 (PDF)








