 |
pRNAT-U6.1/Hygro
| Cat. No. | Size | Price |
|---|---|---|
SD1212-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-U6.1/Hygro | |
Description: pRNAT-U6.1/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell line. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a U6 promoter for siRNA expression.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 78-101
U6 Promoter: 6300-77
CMV Promoter: 140-727
cGFP: 744-1463
SV40 Promoter: 2152-2497
Hygromycin: 2520-3545
pUC ori: 4215-4855
Ampicillin: 5003-5863
Vector Sequence and Restriction Enzyme Map
* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
Publications used this GenScript product:
- Ming Kei Lee and Kanaga Sabapathy. The R246S hot-spot p53 mutant exerts dominant-negative effects in embryonic stem cells in vitro and in vivo. J. Cell Sci. Jun 2008; 121(11): 1899 - 1906
- Michael J. MacDonald, Andrew D. Smith, III, Noaman M. Hasan, Grzegorz Sabat, and Leonard A. Fahien. Feasibility of pathways for transfer of acyl groups from mitochondria to the cytosol to form short chain acyl-CoAs in the pancreatic beta cell. J. Biol. Chem. Oct 2007; 282: 30596 - 30606
- Hellebrekers DM, Melotte V, Vire E, Langenkamp E, Molema G, Fuks F, Herman JG, Van Criekinge W, Griffioen AW, van Engeland M. Identification of epigenetically silenced genes in tumor endothelial cells. Cancer Res. May 2007; 67(9): 4138-4148
- Gonczi M, Szentandrassy N, Johnson IT, Heagerty AM, Weston AH. Investigation of the role of TASK-2 channels in rat pulmonary arteries; pharmacological and functional studies following RNA interference procedures. Br. J. Pharmacol. Mar 2006; 147(5): 496-505
- Ping Gao, Ronald L Wange, Ning Zhang, Joost J Oppenheim, and O. M.Zack Howard. Negative regulation of CXCR4-mediated chemotaxis by the lipid phosphatase activity of tumor suppressor PTEN. Blood. Jun 2005; 106(8): 2619-2626
PRODUCTINFO: 20051023221302 (PDF)