pRNAT-H1.1/Neo
| Cat. No. | Size | Price |
|---|---|---|
SD1213-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-H1.1/Neo | |
Description: pRNAT-H1.1/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses H1 promoter for siRNA expression.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 6102-6125
H1 Promoter: 6002-6101
CMV Promoter: 37-624
cGFP: 641-1360
SV40 Promoter: 2049-2394
Neomycin: 2435-3229
pUC ori: 3943-4583
Ampicillin: 4731-5591
Vector Sequence and Restriction Enzyme Map
* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
Publications used this GenScript product:
- Wang YW, Qu Y, Li JF, Chen XH, Liu BY, Gu QL, Zhu ZG. In vitro and In vivo Evidence of Metallopanstimulin-1 in Gastric Cancer Progression and Tumorigenicity. Clinical Cancer Research. Aug 2006; 12(16): 4965-4973
- Yang X, Xu P, Xiao Y, Xiong X, Xu T. Domain requirement for the membrane trafficking and targeting of syntaxin 1A. J. Biol. Chem. Jun 2006; 281(22): 15457-15463
- Yang X, Xu P, Xiao Y, Xiong X, Xu T. Domain requirement for the membrane trafficking and targeting of syntaxin 1A. J. Biol. Chem. Jun 2006; 281(22): 15457-15463
- Pan PY, Cai Q, Lin L, Lu PH, Duan SM, Sheng ZH. Snap-29-mediated modulation of synaptic transmission in cultured hippocampal neurons. J. Biol. Chem. Jul 2005; 280(27): 25769-25779
PRODUCTINFO: 20051023223311 (PDF)








