You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-H1.1/Hygro   

pRNAT-H1.1/Hygro

Cat. No.SizePrice
SD1214-10 ug
10 ug $ 350.00
Full NamepRNAT-H1.1/Hygro

Description: pRNAT-H1.1/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a Hygromycin resistance gene as the selectable marker which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses H1 promoter for siRNA expression.


Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 6271-6294
H1 Promoter: 6171-6270
CMV Promoter: 37-624
cGFP: 641-1360
SV40 Promoter: 2049-2394
Hygromycin: 2417-3442
pUC ori: 4112-4752
Ampicillin: 4900-5760

Vector Sequence and Restriction Enzyme Map

* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
DATASHEET:  20051023224009  (PDF)

Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.