pRNAT-H1.1/Shuttle
| Cat. No. | Size | Price |
|---|---|---|
SD1216-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-H1.1/Shuttle | |
pRNAT-H1.1/Shuttle
Description
pRNAT-H1.1/Shuttle is an adenoviral siRNA shuttle vector. It is compatible with the Clontech Adeno-XTM Expression System 1. It carries a GFP marker (coral GFP, cGFP) under CMV promoter control. This marker can be used to track the transfection efficiency. It uses an H1 promoter for siRNA expression.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0165
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 6164-6187
H1 Promoter: 6064-6163
CMV Promoter: 37-624
cGFP: 641-1357
SV40 Promoter: 2085-2430
Neomycin: 2471-3265
pUC ori: 3979-4619
Ampicillin: 4767-5627
Vector Sequence and Restriction Enzyme Map
* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
Publications used this GenScript product:
- Liling Yang, Shuxing Wang, Backil Sung, Grewo Lim, and Jianren Mao. Morphine induces ubiquitin-proteasome activity and glutamate transporter degradation. J. Biol. Chem. Aug 2008; 283(31): 21703 - 21713
- Yoshihide Asano, Joanna Czuwara-Ladykowska, Maria Trojanowska. TGF-β regulates DNA binding activity of transcription factor Fli1 by PCAF-dependent acetylation. J. Biol. Chem. Nov 2007; 282(48): 34672 - 34683
- Pannu J, Nakerakanti S, Smith E, Dijke PT, Trojanowska M. TGF-beta receptor type Idependent fibrogenic gene program is mediated via activation of smad1 and ERK1/2 pathways. J. Biol. Chem. Apr 2007; 282(14): 10405-10413
- Nakerakanti SS, Kapanadze B, Yamasaki M, Markiewicz M, Trojanowska M. FLI1 and Ets1 have distinct roles in the CTGF/CCN2 gene regulation and induction of the profibrotic gene program. J. Biol. Chem. Sep 2006; 281(35): 25259-25269
- Feng Yin, April M Hoggatt, Jiliang Zhou, and B. Paul Herring. The 130kDa Smooth Muscle Myosin Light Chain Kinase is Transcribed from a CArG-Dependent, Internal Promoter Within the Mouse MYLK Gene. Am. J. Physiol Cell Physiol. Jun 2006; 290(6): C1599-1609
- El-Mounayri OA, Triplett JW, Yates CW, Herring BP. Regulation of smooth muscle-specific gene expression by homeodomain proteins, Hoxa-10 and Hoxb-8. J. Biol. Chem. Jul 2005; 280(27): 25854-25863
- Jiliang Zhou and B. Paul Herring. Mechanisms responsible for the promoter specific effects of myocardin. J. Biol. Chem. Jan 2005; 280(11): 10861-10869








