You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors »  pRNAT-H1.1/Adeno

pRNAT-H1.1/Adeno

Cat. No.	Size	Price
SD1219-10 ug	10 ug	$ 350.00
Full Name	pRNAT-H1.1/Adeno

Description: GenScript pRNAT-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An H1 promoter is used to drive siRNA expression. The vector contains a cGFP marker under the control of cytomegalovirus (CMV) promoter^*, which can be used to track transfection efficiency. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication.

Storage Buffer and Concentration: -20°C

Download Protocol: tm0165

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)

Detailed Map:
pBR322 origin: 5602-6269
Kanamycin: 7059-7850
Polylinker: 2112-2141
H1 Promoter: 2012-2111
CMV Promoter: 1944-1356
cGFP: 1333-622

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Taka-aki Matsuoka, Hideaki Kaneto, Roland Stein, Takeshi Miyatsuka, Dan Kawamori, Eva Henderson, Itaru Kojima, Munehide Matsuhisa, Masatsugu Hori, and Yoshimitsu Yamasaki. MafA regulates expression of genes important to islet ß-cell function. Molecular Endocrinology. Nov 2007; 21(11): 2764 - 2774

• Little G, Bai Y, Williams T, Poizat C. Nuclear caMKIIdelta preferentially transmits signals to HDAC4 in cardiac cells. J. Biol. Chem. Mar 2007; 282(10): 7219-7231

• Kawamori D, Kaneto H, Nakatani Y, Matsuoka TA, Matsuhisa M, Hori M, Yamasaki Y. The forkhead transcription factor Foxo1 bridges the JNK pathway and the transcription factor PDX-1 through its intracellular translocation. J. Biol. Chem. Jan 2006; 281(2): 1091-1098