pRNAin-H1.2/Neo

Cat. No.SizePrice
SD1220-10 ug
10 ug $ 350.00
Full NamepRNAin-H1.2/Neo

Description: pRNAin-H1.2/Neo is a GenScript inducible siRNA expression vector. The H1.2 promoter is an inducible promoter* containing a tetracycline operator (TetO1). The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site, derepressing the transcription from the H1 promoter.

pRNAin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line.



Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 4700-4770
H1 Promoter: 4600-4699
SV40 Promoter: 647-992
Neomycin: 1033-1827
pUC ori: 2541-3181
Ampicillin: 3329-4189

Vector Sequence and Restriction Enzyme Map

* Limited Use Label License: This product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product.

Publications used this GenScript product:


PRODUCTINFO:  20051023225307  (PDF)

1
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.