You are here:  Products » PCR and Cloning » siRNA Expression Vector »  pRNAin-H1.2/Neo   

pRNAin-H1.2/Neo

Cat. No.SizePrice
SD1220-10 ug
10 ug $ 350.00
Full NamepRNAin-H1.2/Neo

pRNAin-H1.2/Neo

Description
pRNAin-H1.2/Neo is a GenScript inducible siRNA expression vector. The H1.2 promoter is an inducible promoter* containing a tetracycline operator (TetO1). The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site, derepressing the transcription from the H1 promoter.

pRNAin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line.




Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 4700-4770
H1 Promoter: 4600-4699
SV40 Promoter: 647-992
Neomycin: 1033-1827
pUC ori: 2541-3181
Ampicillin: 3329-4189

Vector Sequence and Restriction Enzyme Map

* Limited Use Label License: This product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product.

Publications used this GenScript product: