Molecular Biology Products
You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors »  pRNATin-H1.2/Neo   

pRNATin-H1.2/Neo

Cat. No.SizePrice
SD1223-10 ug
 		10 ug $ 350.00
Full NamepRNATin-H1.2/Neo

Description: pRNATin-H1.2/Neo is a GenScript inducible siRNA expression vector. The H1.2 promoter is an engineered inducible promoter* containing a tetracycline operator (TetO1). The Tetracycline operator itself has no effect on expression unless the tetracycline repressor (TetR) is present. In the presence of TetR, the promoter effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site and derepressing the transcription from the H1 promoter.

pRNATin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene, which can be used for establishing stable cell lines, and a GFP (coral GFP) marker under CMV promoter** control to track transfection efficiency.


Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 6122-18
H1 Promoter: 6022-6121
CMV Promoter: 57-644
cGFP: 661-1380
SV40 Promoter: 2069-2414
Neomycin: 2455-3249
pUC ori: 3963-4603
Ampicillin: 4751-5611

Vector Sequence and Restriction Enzyme Map

* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.

* Limited Use Label License: This product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product.

Publications used this GenScript product:


PRODUCTINFO:  20051023225522  (PDF)
Related Products:
  • Precast Gels
    • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    		 Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    		 PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    		 Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    		 Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.