|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors » pRNATin-H1.2/Neo
|
pRNATin-H1.2/Neo
| Cat. No. | Size | Price |
|---|---|---|
SD1223-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNATin-H1.2/Neo | |
Description: pRNATin-H1.2/Neo is a GenScript inducible siRNA expression vector. The H1.2 promoter is an engineered inducible promoter* containing a tetracycline operator (TetO1). The Tetracycline operator itself has no effect on expression unless the tetracycline repressor (TetR) is present. In the presence of TetR, the promoter effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site and derepressing the transcription from the H1 promoter.
pRNATin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene, which can be used for establishing stable cell lines, and a GFP (coral GFP) marker under CMV promoter** control to track transfection efficiency.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 6122-18
H1 Promoter: 6022-6121
CMV Promoter: 57-644
cGFP: 661-1380
SV40 Promoter: 2069-2414
Neomycin: 2455-3249
pUC ori: 3963-4603
Ampicillin: 4751-5611
Vector Sequence and Restriction Enzyme Map
* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.
* Limited Use Label License: This product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product.
Publications used this GenScript product:
- Kristi A. Hohenstein, April D. Pyle, Jing Yi Chern, Leslie F. Lock, and Peter J. Donovan. Nucleofection Mediates High-efficiency Stable Gene Knockdown and Transgene Expression in Human Embryonic Stem Cells. Stem Cells. Jun 2008; 26(6): 1436 - 1443
- Adiseshaiah P, Kalvakolanu DV, Reddy SP. A JNK-Independent Signaling Pathway Regulates TNF{alpha}-Stimulated, c-Jun-Driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells. J. Immunol. Nov 2006; 177(10): 7193-7202
- Fei Guo,Kathy Rocha,Purva Bali,Michael Pranpat,Warren Fiskus,Sandhya Boyapalle,Sandhya Kumaraswamy,Maria Balasis,Benjamin Greedy,E.Simon M.Armitage,Nicholas Lawrence,and Kapil Bhalla. Abrogation of Heat Shock Protein 70 Induction as a Strategy to Increase Antileukemia Activity of Heat Shock Protein 90 Inhibitor 17-Allylamino-Demethoxy Geldanamycin. Cancer Res. Nov 2005; 65(22): 10536-10544
PRODUCTINFO: 20051023225522 (PDF)









