pRNATin-H1.2/Hygro

Cat. No.SizePrice
SD1224-10 ug
10 ug $ 350.00
Full NamepRNATin-H1.2/Hygro

Description: pRNATin-H1.2/Hygro is a GenScript inducible siRNA expression vector. The H1.2 promoter is an engineered inducible promoter* containing a tetracycline operator (TetO1). The Tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site, and derepressing the transcription from the H1 promoter.

pRNATin-H1.2/Hygro is designed for mammalian transfection. It carries a Hygromycin resistance gene which can be used for establishing stable cell line and a GFP (coral GFP) marker under CMV promoter** control to track the transfection efficiency



Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 6271-6294
H1 Promoter: 6171-6270
CMV Promoter: 37-624
cGFP: 641-1360
SV40 Promoter: 2049-2394
Hygromycin: 2417-3436
pUC ori: 4112-4752
Ampicillin: 4900-5760

Vector Sequence and Restriction Enzyme Map

* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.

* Limited Use Label License: This product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product.

Publications used this GenScript product:


PRODUCTINFO:  20051023225805  (PDF)
Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.