You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors »  pRNATin-H1.2/Adeno

pRNATin-H1.2/Adeno

Cat. No.	Size	Price
SD1229-10 ug	10 ug	$ 350.00
Full Name	pRNATin-H1.2/Adeno

Description: GenScript's pRNATin-H1.2/Adeno is an adenoviral siRNA shuttle vector.It is compatible with the Stratagene AdEasy Adenoviral Vector System.It uses an inducible H1 promoter* for siRNA expression.The promoter contains a tetracycline operator (TetO1) which can be used to regulate siRNA expression. The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR, causing the TetR protein to release the TetO1 site, derepressing transcription.

pRNATin-H1.2/Adeno is designed for mammalian transfection. The cGFP marker is under cytomegalovirus (CMV) promoter** control for tracking transfection efficiency.The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available for recombinant viral DNA replication.

Storage Buffer and Concentration: Store the product at - 20°C

Download Protocol: tm0165

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)

Detailed Map:
pBR322 origin: 5591-6258
Kanamycin: 7048-7839
Polylinker: 2112-2141
H1 Promoter: 2012-2111
CMV Promoter: 1947-1356
cGFP: 1339-622

Vector Sequence and Restriction Enzyme Map
MAP:

Zoom

PRODUCTINFO:  20051023230112  (PDF)