|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors » pRNATin-H1.2/Adeno
|
pRNATin-H1.2/Adeno
| Cat. No. | Size | Price |
|---|---|---|
SD1229-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNATin-H1.2/Adeno | |
Description: GenScript's pRNATin-H1.2/Adeno is an adenoviral siRNA shuttle vector.It is compatible with the Stratagene AdEasy Adenoviral Vector System.It uses an inducible H1 promoter* for siRNA expression.The promoter contains a tetracycline operator (TetO1) which can be used to regulate siRNA expression. The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR, causing the TetR protein to release the TetO1 site, derepressing transcription.

pRNATin-H1.2/Adeno is designed for mammalian transfection. The cGFP marker is under cytomegalovirus (CMV) promoter** control for tracking transfection efficiency.The vector also contains a kanamycin resistance gene for transformant selection. LITR and
RITR regions are available for recombinant viral DNA replication.

Storage Buffer and Concentration: Store the product at - 20°C
Download Protocol: tm0165
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)
Detailed Map:
pBR322 origin: 5591-6258
Kanamycin: 7048-7839
Polylinker: 2112-2141
H1 Promoter: 2012-2111
CMV Promoter: 1947-1356
cGFP: 1339-622
Vector Sequence and Restriction Enzyme Map
MAP:
Zoom
PRODUCTINFO: 20051023230112 (PDF)
![]() |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |









