You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNA-CMV3.1/Hygro

pRNA-CMV3.1/Hygro

Cat. No.	Size	Price
SD1232-10 ug	10 ug	$ 225.00
Full Name	pRNA-CMV3.1/Hygro

Description: Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines, compared with RNA polymerase III based promoters such as U6 and H1. In this vector, CMV promoter drives the expression of siRNA, and SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Hind III sites. siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’)

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0172

Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 584-651
CMV Promoter: 1-583
SV40 Promoter: 1267-1612
Hygromycin: 1635-2654
pUC ori: 3330-3970
Ampicillin: 4118-4978

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Rahnama F, Shafiei F, Gluckman PD, Mitchell MD, Lobie PE. Epigenetic regulation of human trophoblastic cell migration and invasion. Endocrinology. Nov 2006; 147(11): 5275-5283

PRODUCTINFO:  20051023233408  (PDF)
PROTOCOL:  20050718094354  (PDF)

1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.