You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors »  pRNAin-H1.2/Shuttle

pRNAin-H1.2/Shuttle

Cat. No.	Size	Price
SD1234-10 ug	10 ug	$ 350.00
Full Name	pRNAin-H1.2/Shuttle

Description: pRNAin-H1.2/Shuttle is a GenScript adenoviral siRNA shuttle vector. It uses an inducible H1 promoter* for siRNA expression. This promoter contains a tetracycline operator (TetO1). As a competitor, tetracycline or doxycycline can bind this operator to remove the blockade of tetracycline repressor (TetR) from H1 promoter and induce the transcription of siRNA.

pRNAin-H1.2/Shuttle is designed for mammalian transfection. It also contains a neomycin resistance gene under SV40 promoter control for establishing stable cell line.

Storage Buffer and Concentration: -20°C

Download Protocol: tm0165

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 4727-4750
H1 Promoter: 4627-4726
SV40 Promoter: 674-1019
Neomycin: 1060-1854
pUC ori: 2568-3208
Ampicillin: 3356-4216

Vector Sequence and Restriction Enzyme Map
DATASHEET:  20051023235958  (PDF)
PROTOCOL:  20050517003536  (PDF)

1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.