|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors » pRNAin-H1.2/Shuttle
|
pRNAin-H1.2/Shuttle
| Cat. No. | Size | Price |
|---|---|---|
SD1234-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAin-H1.2/Shuttle | |
Description: pRNAin-H1.2/Shuttle is a GenScript adenoviral siRNA shuttle vector. It is compatible with Clontech Adeno-XTM Expression System 1. It uses an inducible H1 promoter* for siRNA expression. This promoter contains a tetracycline operator (TetO1). As a competitor, tetracycline or doxycycline can bind this operator to remove the blockade of tetracycline repressor (TetR) from H1 promoter and induce the transcription of siRNA.

pRNAin-H1.2/Shuttle is designed for mammalian transfection. It also contains a neomycin resistance gene under SV40 promoter control for establishing stable cell line.

Storage Buffer and Concentration: -20°C
Download Protocol: tm0165
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 4727-4750
H1 Promoter: 4627-4726
SV40 Promoter: 674-1019
Neomycin: 1060-1854
pUC ori: 2568-3208
Ampicillin: 3356-4216
Vector Sequence and Restriction Enzyme Map
DATASHEET: 20051023235958 (PDF)
PROTOCOL: 20050517003536 (PDF)








