You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors »  pRNA-H1.1/Retro

pRNA-H1.1/Retro

Cat. No.	Size	Price
SD1241-10 ug	10 ug	$ 225.00
Full Name	pRNA-H1.1/Retro

Description: pRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives siRNA expression. the siRNA insert cloned between the Mlu and Xho sites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR). It uses MSV 3'LTR for viral transcription and packaging.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: TM0187

Forward Sequencing Primer:
DA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)

Reverse Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Detailed Map:
5' LTR: 1-727
3' LTR: 4768-5063
psi+: 757-1566
ColE1 ori: 6650-5764
SV40 ori & promoter: 5320-5664
Polylinker: 4596-4619
H1 Promoter: 4719-4620
CMV Promoter: 1604-2132
Hygromycin: 2901-3921
Ampicillin: 7570-6710

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Qing Shao, Hongling Wang, Elizabeth McLachlan, Gregory I.L. Veitch, and Dale W. Laird. Down-regulation of Cx43 by Retroviral Delivery of Small Interfering RNA Promotes an Aggressive Breast Cancer Cell Phenotype. Cancer. Res. Apr 2005; 65(7): 2705-2711

1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.