|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors » pRNAT-H1.4/Retro
|
pRNAT-H1.4/Retro
| Cat. No. | Size | Price |
|---|---|---|
SD1253-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-H1.4/Retro | |
Description: pRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives the siRNA expression with the siRNA insert cloned between MluⅠ and XhoⅠsites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: TM0187
Forward Sequencing Primer:
DA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)
Reverse Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Detailed Map:
5' LTR: 1-727
3' LTR: 5460-5755
psi+: 757-1566
ColE1 ori: 6456-7342
SV40 ori & promoter: 6012-6356
IRES: 2975-3555
Polylinker: 5288-5311
H1 Promoter: 5312-5411
CMV Promoter: 1604-2132
cGFP: 2247-2966
Hygromycin: 3593-4613
Ampicillin: 7402-8262
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Dympna Harmey, Anthony Smith, Scott Simanski, Carole Zaki Moussa, and Nagi G. Ayad. The anaphase promoting complex induces substrate degradation during neuronal differentiation. J. Biol. Chem. Dec 2008;
PRODUCTINFO: 20051123022221 (PDF)








