|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors » pRNAT-H1.4/Retro
 |
pRNAT-H1.4/Retro
| Cat. No. | Size | Price |
|---|---|---|
SD1253-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-H1.4/Retro | |
Description: pRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives the siRNA expression with the siRNA insert cloned between MluⅠ and XhoⅠsites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: TM0187
Forward Sequencing Primer:
DA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)
Reverse Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Detailed Map:
5' LTR: 1-727
3' LTR: 5460-5755
psi+: 757-1566
ColE1 ori: 6456-7342
SV40 ori & promoter: 6012-6356
IRES: 2975-3555
Polylinker: 5288-5311
H1 Promoter: 5312-5411
CMV Promoter: 1604-2132
cGFP: 2247-2966
Hygromycin: 3593-4613
Ampicillin: 7402-8262
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Dympna Harmey, Anthony Smith, Scott Simanski, Carole Zaki Moussa, and Nagi G. Ayad. The anaphase promoting complex induces substrate degradation during neuronal differentiation. J. Biol. Chem. Feb 2009; 284(7): 4317 - 4323
PRODUCTINFO: 20051123022221 (PDF)
 |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |