|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Inducible siRNA Expression Vectors » pRNATin-H1.4/Retro
|
pRNATin-H1.4/Retro
| Cat. No. | Size | Price |
|---|---|---|
SD1254-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNATin-H1.4/Retro | |
Description: An inH1.4 promoter (the same as inH1.2) drives the siRNA expression with the siRNA insert cloned between MluⅠ and XhoⅠsites. pRNA-H1.4/Retro siRNA expression vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: TM0187
Forward Sequencing Primer:
DA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)
Reverse Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Detailed Map:
5' LTR: 1-727
3' LTR: 5460-5755
psi+: 757-1566
ColE1 ori: 6456-7342
SV40 ori & promoter: 6012-6356
IRES: 2975-3555
Polylinker: 5288-5311
H1 Promoter: 5312-5411
CMV Promoter: 1604-2132
cGFP: 2247-2966
Hygromycin: 3593-4613
Ampicillin: 7402-8262
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Huang J, Hu J, Bian X, Chen K, Gong W, Dunlop NM, Howard OM, Wang JM. Transactivation of the epidermal growth factor receptor by formylpeptide receptor exacerbates the malignant behavior of human glioblastoma cells. Cancer Res. Jun 2007; 67(12): 5906-5913
DATASHEET: 20051123023059 (PDF)








