pRNATin-H1.4/Retro

Cat. No.SizePrice
SD1254-10 ug
10 ug $ 350.00
Full NamepRNATin-H1.4/Retro

Description: An inH1.4 promoter (the same as inH1.2) drives the siRNA expression with the siRNA insert cloned between MluⅠ and XhoⅠsites. pRNA-H1.4/Retro siRNA expression vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging.



Storage Buffer and Concentration: Store at -20°C

Download Protocol: TM0187

Forward Sequencing Primer:
DA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)

Reverse Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Detailed Map:
5' LTR: 1-727
3' LTR: 5460-5755
psi+: 757-1566
ColE1 ori: 6456-7342
SV40 ori & promoter: 6012-6356
IRES: 2975-3555
Polylinker: 5288-5311
H1 Promoter: 5312-5411
CMV Promoter: 1604-2132
cGFP: 2247-2966
Hygromycin: 3593-4613
Ampicillin: 7402-8262

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:


DATASHEET:  20051123023059  (PDF)
Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : Mouse Anti-cGFP-tag Monoclonal Antibody40 ug$50.00
    200 ug$225.00