|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors » pRNAT-U6.2/Lenti
 |
pRNAT-U6.2/Lenti
| Cat. No. | Size | Price |
|---|---|---|
SD1259-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-U6.2/Lenti | |
Description: pRNAT-U6.2/Lenti siRNA expression vector is compatible with the Invitrogen ViraPowerTM Lentiviral_Expression System. It is designed for siRNA expression in both dividing and nondividing cells. The siRNA insert can be conveniently cloned between the BamH I and Xho I sites under the control of the U6 promoter. The vector contains a neomycin resistance gene for establishing stable cell lines and a coral GFP gene for tracking transfection efficiency. Both of these are driven by CM and SV40 promoters, respectively. The vector uses HIV 3'LTR for viral transcription and a Rous sarcoma enhancer/promoter joined to HIV 5'LTR (PRSV/5'LTR) for packaging.
Storage Buffer and Concentration: - 20°C
Download Protocol: tm0175
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
5' LTR: 1-410
3' LTR: 4906-5140
ColE1 ori: 7220-8106
Polylinker: 2200-2275
U6 Promoter: 1873-2199
CMV Promoter: 2320-2907
cGFP: 2924-3643
SV40 Promoter: 3651-3996
Neomycin: 4037-4831
Ampicillin: 6300-7160
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051115220744 (PDF)
PROTOCOL: 20050506171639 (PDF)
MSDS: 20080228014414 (PDF)