Molecular Biology Products
You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors »  pRNATin-H1.4/Lenti   
Note:
This product has been discontinued!

pRNATin-H1.4/Lenti

Cat. No.SizePrice
Full NamepRNATin-H1.4/Lenti

Description: pRNAT-in-H1.4/Lenti siRNA expression vector is compatible with the Invitrogen ViraPowerTM Lentiviral-Expression System. The inducible H1.4 promoter, which contains a tetracycline operator (TetO1), is used to drive siRNA expression. In the presence of tetracycline or doxcycline, this promoter will become active and transcription of siRNA will begin. The siRNA insert is cloned between the BamH I and Xho I sites.

The vector also carries a cGFP marker for tracking transfection efficiency and a neomycin resistance gene for establishing stable cell lines. These are driven by a CMV promoter and a SV40 promoter, respectively. The vector uses HIV 3'LTR for viral transcription and Rous sarcoma virus (RSV) enhancer/promoter conjugated to HIV 5’LTR (PRSV/5'LTR) for packaging.



Storage Buffer and Concentration: - 20°C

Download Protocol: tm0175

Forward Sequencing Primer:
DA0027: SD1258 Forward (GGGAAATCACCATAAACGTG)

Reverse Sequencing Primer:
DA0028: SD1258 Reverse (TGGGCTATGAACTAATGACCC)

Detailed Map:
5' LTR: 1-410
3' LTR: 4653-4887
ColE1 ori: 6967-7853
Polylinker: 1947-2022
H1 Promoter: 1847-1946
CMV Promoter: 2067-2654
cGFP: 2671-3390
SV40 Promoter: 3398-3743
Neomycin: 3784-4578
Ampicillin: 6047-6907

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051118015214  (PDF)
PROTOCOL:  20050506171639  (PDF)

Related Products:
  • Precast Gels
    • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    		 Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    		 PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    		 Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    		 Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.