|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Vector » Viral siRNA Vectors » pRNATin-H1.4/Lenti
|
pRNATin-H1.4/Lenti
| Cat. No. | Size | Price |
|---|---|---|
SD1260-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNATin-H1.4/Lenti | |
Description: pRNAT-in-H1.4/Lenti siRNA expression vector is compatible with the Invitrogen ViraPowerTM Lentiviral-Expression System. The inducible H1.4 promoter, which contains a tetracycline operator (TetO1), is used to drive siRNA expression. In the presence of tetracycline or doxcycline, this promoter will become active and transcription of siRNA will begin. The siRNA insert is cloned between the BamH I and Xho I sites.
The vector also carries a cGFP marker for tracking transfection efficiency and a neomycin resistance gene for establishing stable cell lines. These are driven by a CMV promoter and a SV40 promoter, respectively. The vector uses HIV 3'LTR for viral transcription and Rous sarcoma virus (RSV) enhancer/promoter conjugated to HIV 5’LTR (PRSV/5'LTR) for packaging.

Storage Buffer and Concentration: - 20°C
Download Protocol: tm0175
Forward Sequencing Primer:
DA0027: SD1258 Forward (GGGAAATCACCATAAACGTG)
Reverse Sequencing Primer:
DA0028: SD1258 Reverse (TGGGCTATGAACTAATGACCC)
Detailed Map:
5' LTR: 1-410
3' LTR: 4653-4887
ColE1 ori: 6967-7853
Polylinker: 1947-2022
H1 Promoter: 1847-1946
CMV Promoter: 2067-2654
cGFP: 2671-3390
SV40 Promoter: 3398-3743
Neomycin: 3784-4578
Ampicillin: 6047-6907
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051118015214 (PDF)
PROTOCOL: 20050506171639 (PDF)








