pRNAT-CMV3.1/Neo
| Cat. No. | Size | Price |
|---|
SD1261-10 ug
| 10 ug | $ 350.00 |
|---|
| Full Name | pRNAT-CMV3.1/Neo |
|---|
Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines than RNA-polymerase-III-based promoters such as U6 and H1. In this vector, the CMV promoter drives the expression of siRNA and a SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Afl II sites.
The siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’). This vector also carries cGFP (coral GFP) for convenient tracking of transfection efficiency.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0172
Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
Neomycin: 2936-3730
pUC ori: 4444-5084
Ampicillin: 5232-6092
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051024021421 (PDF)
PROTOCOL: 20050718094354 (PDF)
