You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-CMV3.1/Hygro

pRNAT-CMV3.1/Hygro

Cat. No.	Size	Price
SD1262-10 ug	10 ug	$ 350.00
Full Name	pRNAT-CMV3.1/Hygro

Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines, compared with RNA polymerase III based promoters such as U6 and H1. In this vector, CMV promoter drives the expression of siRNA, and SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Afl II sites. siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’) This vector also carries cGFP (coral GFP) for convenient tracking of transfection efficiency.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0172

Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
Hygromycin: 2911-3936
pUC ori: 4636-5276
Ampicillin: 5424-6284

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:

• Evseenko DA, Murthi P, Paxton JW, Reid G, Emerald BS, Mohankumar KM, Lobie PE, Brennecke SP, Kalionis B, Keelan JA. The ABC transporter BCRP/ABCG2 is a placental survival factor, and its expression is reduced in idiopathic human fetal growth restriction. FASEB．J. Jun 2007;

DATASHEET:  20051024021713  (PDF)
PROTOCOL:  20050718094354  (PDF)

Related Products: Precast Gels Code Name Size Price   A00185 antibody : Mouse Anti-cGFP-tag Monoclonal Antibody 40 ug $50.00 200 ug $225.00