pRNAT-CMV3.1/Puro
| Cat. No. | Size | Price |
|---|
SD1263-10 ug
| 10 ug | $ 350.00 |
|---|
| Full Name | pRNAT-CMV3.1/Puro |
|---|
The human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on the RNA polymerase II system, the CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines than RNA polymerase III-based promoters, such as U6 and H1. A CMV promoter drives the expression of siRNA, and an SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between
BamH I and
Afl II sites. The siRNA sequence can be confirmed by DNA sequencing using reverse sequencing primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’). This vector also carries cGFP (coral GFP) for convenient tracking of transfection efficiency.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0172
Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Puromycin: 2911-3510
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
pUC ori: 4210-4850
Ampicillin: 4998-5858
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051024022606 (PDF)
PROTOCOL: 20050718094354 (PDF)
