pRNAT-CMV3.2/Neo
| Cat. No. | Size | Price |
|---|
SD1264-10 ug
| 10 ug | $ 350.00 |
|---|
| Full Name | pRNAT-CMV3.2/Neo |
|---|
Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines, compared with RNA polymerase III based promoters such as U6 and H1. In this vector, CMV promoter drives the expression of siRNA, and SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Xho I sites.
siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’)
This vector also carries cGFP (coral GFP) for convenient tracking of transfection efficiency.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0172
Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
Neomycin: 2936-3730
pUC ori: 4444-5084
Ampicillin: 5232-6092
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051114201559 (PDF)
PROTOCOL: 20050718094354 (PDF)
