pRNAT-CMV3.2/Hygro
| Cat. No. | Size | Price |
|---|---|---|
SD1265-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-CMV3.2/Hygro | |

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0172
Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
Hygromycin: 2911-3936
pUC ori: 4636-5276
Ampicillin: 5424-6284
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051114031700 (PDF)
PROTOCOL: 20050718094354 (PDF)
![]() |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |









