You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-CMV3.2/Puro   

pRNAT-CMV3.2/Puro

Cat. No.SizePrice
SD1266-10 ug
10 ug $ 350.00
Full NamepRNAT-CMV3.2/Puro
The human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on the RNA polymerase II system, the CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines, than RNA-polymerase III-based promoters such as U6 and H1. In this vector, a CMV promoter drives the expression of siRNA, and an SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Xho I sites.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0172

Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Puromycin: 2911-3510
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
pUC ori: 4210-4850
Ampicillin: 4998-5858

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051114033755  (PDF)
PROTOCOL:  20050718094354  (PDF)

Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.