Molecular Biology Products
You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-CMV3.2/Puro   

pRNAT-CMV3.2/Puro

Cat. No.SizePrice
SD1266-10 ug
 		10 ug $ 350.00
Full NamepRNAT-CMV3.2/Puro
The human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on the RNA polymerase II system, the CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines, than RNA-polymerase III-based promoters such as U6 and H1. In this vector, a CMV promoter drives the expression of siRNA, and an SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Xho I sites.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0172

Forward Sequencing Primer:
DA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Puromycin: 2911-3510
Polylinker: 584-651
CMV Promoter: 1-583
cGFP: 1598-2317
SV40 Promoter: 1267-1598
pUC ori: 4210-4850
Ampicillin: 4998-5858

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051114033755  (PDF)
PROTOCOL:  20050718094354  (PDF)

Related Products:
  • Precast Gels
    • CodeNameSizePrice 
    A00185 antibody : Mouse Anti-cGFP-tag Monoclonal Antibody40 ug$50.00
    200 ug$225.00