You are here:  Products » Molecular Biology Products » Vectors » siRNA Controls » Positive Controls »  pRNAT-U6.1/Hygro/siFLuc   

pRNAT-U6.1/Hygro/siFLuc

Cat. No.SizePrice
SD1512-10 ug
10 ug $ 225.00
Full NamepRNAT-U6.1/Hygro/siFLuc

Description: pRNAT-U6.1/Hygro/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP), which is under CMV promoter control, can be used to track the transfection efficiency. It uses a U6 promoter for siRNA expression. This vector contains an siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.



Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 78-147
U6 Promoter: 6354-77
CMV Promoter: 186-782
cGFP: 798-1517
SV40 Promoter: 2206-2551
Hygromycin: 2574-3599
pUC ori: 4269-4909
Ampicillin: 5057-5917

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051024024027  (PDF)


1
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.