Molecular Biology Products
You are here:  Products » Molecular Biology Products » Vectors » siRNA Controls » Positive Controls »  pRNATin-H1.2/Neo/siFLuc   

pRNATin-H1.2/Neo/siFLuc

Cat. No.SizePrice
SD1523-10 ug
 		10 ug $ 225.00
Full NamepRNATin-H1.2/Neo/siFLuc

Description: pRNATin-H1.2/Neo/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) , which is under CMV promoter control, can be used to track the transfection efficiency. It uses the H1.2 promoter, an engineered inducible promoter containing a tetracycline operator (TetO1), for siRNA expression. This vector contains an siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as an siRNA vector using BamH I and Hind III for siRNA insertion.





Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 6168-64
H1 Promoter: 6068-6167
CMV Promoter: 103-691
cGFP: 707-1426
SV40 Promoter: 2115-2460
Neomycin: 2501-3295
pUC ori: 4009-4649
Ampicillin: 4797-5657

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051024024323  (PDF)
PROTOCOL:  20050506154231  (PDF)


1
 Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2
 PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3
 Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4
 Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.