 |
pRNA-U6.3/Neo
| Cat. No. | Size | Price |
|---|---|---|
SD1550-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-U6.3/Neo | |
Description: pRNA-U6.3/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell lines. It uses a U6 promoter for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.
Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
CMV IE: 4808-5291
siFluc: 84-141
Polylinker: 78-147
U6 Promoter: 5298-77
SV40 Promoter: 896-1241
Neomycin: 1282-2076
pUC ori: 2790-3430
Ampicillin: 3578-4438
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051024025411 (PDF)
 |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |