|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Controls » Positive Controls » pRNA-H1.3/Neo/siFLuc
|
pRNA-H1.3/Neo/siFLuc
| Cat. No. | Size | Price |
|---|---|---|
SD1553-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-H1.3/Neo/siFLuc | |
Description: pRNA-H1.3/Neo/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. This vector contains siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.


Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0024: pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
CMV IE: 4559-5042
siFluc: 5148-5205
Polylinker: 5142-5211
H1 Promoter: 5049-5143
SV40 Promoter: 647-992
Neomycin: 1033-1827
pUC ori: 2541-3181
Ampicillin: 3329-4189
Vector Sequence and Restriction Enzyme Map
DATASHEET: 20051024030347 (PDF)








