You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-U6.3/Hygro   

pRNAT-U6.3/Hygro

Cat. No.SizePrice
SD1561-10 ug
10 ug $ 350.00
Full NamepRNAT-U6.3/Hygro

Description: pRNAT-U6.3/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It has a GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses a enhanced U6 promoter (modified by a CMV enhancer just before the region) for siRNA expression. The siRNA insert can be cloned between the BamH I and Hind III sites.




Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
CMV IE: 7-490
Polylinker: 824-893
U6 Promoter: 497-823
CMV Promoter: 932-1519
cGFP: 1536-2255
SV40 Promoter: 2944-3289
Hygromycin: 3312-4337
pUC ori: 5007-5647
Ampicillin: 5795-6655

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051024032248  (PDF)

Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : Mouse Anti-cGFP-tag Monoclonal Antibody40 ug$50.00
    200 ug$225.00