You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-U6.3/Hygro   

pRNAT-U6.3/Hygro

Cat. No.SizePrice
SD1561-10 ug
10 ug $ 350.00
Full NamepRNAT-U6.3/Hygro

Description: pRNAT-U6.3/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It has a GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses a enhanced U6 promoter (modified by a CMV enhancer just before the region) for siRNA expression. The siRNA insert can be cloned between the BamH I and Hind III sites.




Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
CMV IE: 7-490
Polylinker: 824-893
U6 Promoter: 497-823
CMV Promoter: 932-1519
cGFP: 1536-2255
SV40 Promoter: 2944-3289
Hygromycin: 3312-4337
pUC ori: 5007-5647
Ampicillin: 5795-6655

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051024032248  (PDF)

Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.