pRNAT-H1.3/Hygro
| Cat. No. | Size | Price |
|---|---|---|
SD1563-10 ug
| 10 ug | $ 350.00 |
| Full Name | pRNAT-H1.3/Hygro | |
Description: pRNAT-H1.3/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell lines. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0032: SD1563 Forward (CTGGGAAATCACCATAAACG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
CMV IE: 7-490
Polylinker: 590-659
H1 Promoter: 497-591
CMV Promoter: 698-1285
cGFP: 1302-2021
SV40 Promoter: 2710-3055
Hygromycin: 3078-4103
pUC ori: 4773-5413
Ampicillin: 5561-6421
Vector Sequence and Restriction Enzyme Map
Publications used this GenScript product:
- Kanda T, Steele R, Ray R, Ray RB. Small Interfering RNA Targeted to Hepatitis C Virus 5' Nontranslated Region Exerts Potent Antiviral Effect. J. Virol. Jan 2007; 81(2): 669-676
PRODUCTINFO: 20051024032633 (PDF)








