You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-H1.3/Hygro   

pRNAT-H1.3/Hygro

Cat. No.SizePrice
SD1563-10 ug
10 ug $ 350.00
Full NamepRNAT-H1.3/Hygro

Description: pRNAT-H1.3/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell lines. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.




Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0032: SD1563 Forward (CTGGGAAATCACCATAAACG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
CMV IE: 7-490
Polylinker: 590-659
H1 Promoter: 497-591
CMV Promoter: 698-1285
cGFP: 1302-2021
SV40 Promoter: 2710-3055
Hygromycin: 3078-4103
pUC ori: 4773-5413
Ampicillin: 5561-6421

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:


PRODUCTINFO:  20051024032633  (PDF)
Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : Mouse Anti-cGFP-tag Monoclonal Antibody40 ug$50.00
    200 ug$225.00