You are here:  Products » Molecular Biology Products » Vectors » siRNA Vector »  pRNAT-H1.3/Hygro   

pRNAT-H1.3/Hygro

Cat. No.SizePrice
SD1563-10 ug
10 ug $ 350.00
Full NamepRNAT-H1.3/Hygro

Description: pRNAT-H1.3/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell lines. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.




Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0032: SD1563 Forward (CTGGGAAATCACCATAAACG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
CMV IE: 7-490
Polylinker: 590-659
H1 Promoter: 497-591
CMV Promoter: 698-1285
cGFP: 1302-2021
SV40 Promoter: 2710-3055
Hygromycin: 3078-4103
pUC ori: 4773-5413
Ampicillin: 5561-6421

Vector Sequence and Restriction Enzyme Map

Publications used this GenScript product:


PRODUCTINFO:  20051024032633  (PDF)
Related Products:
  • Precast Gels
  • CodeNameSizePrice 
    A00185 antibody : cGFP-tag Antibody, mAb, Mouse40 ug$50.00
    200 ug$225.00



    1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.