|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Controls » Positive Controls » pRNAT-U6.3/Hygro/siFLuc
|
pRNAT-U6.3/Hygro/siFLuc
| Cat. No. | Size | Price |
|---|---|---|
SD1565-10 µg
| 10 µg | $ 350.00 |
| Full Name | pRNAT-U6.3/Hygro/siFLuc | |
Description: pRNAT-U6.3/Hygro/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses an enhanced U6 promoter (enhanced by a CMV enhancer just before U6 promoter) for siRNA expression. This vector contains siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
CMV IE: 7-490
siFluc: 830-887
Polylinker: 824-893
U6 Promoter: 497-823
CMV Promoter: 932-1519
cGFP: 1536-2255
SV40 Promoter: 2944-3289
Hygromycin: 3312-4337
pUC ori: 5007-5647
Ampicillin: 5795-6655
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051215025502 (PDF)








