You are here:  Products » Molecular Biology Products » Vectors » siRNA Controls » Positive Controls »  pRNAT-H1.3/Hygro/siFLuc

pRNAT-H1.3/Hygro/siFLuc

Cat. No.	Size	Price
SD1566-10 µg	10 µg	$ 350.00
Full Name	pRNAT-H1.3/Hygro/siFLuc

Description: a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. This vector contains the siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0032: SD1563 Forward (CTGGGAAATCACCATAAACG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
CMV IE: 7-490
siFluc: 596-653
Polylinker: 590-659
H1 Promoter: 497-591
CMV Promoter: 698-1285
cGFP: 1302-2021
SV40 Promoter: 2710-3055
Hygromycin: 3078-4103
pUC ori: 4773-5413
Ampicillin: 5561-6421

Vector Sequence and Restriction Enzyme Map
DATASHEET:  20051215031925  (PDF)