You are here:  Products » Molecular Biology Products » Vectors » siRNA Controls » Negative Controls »  pRNA-U6.1/Neo/CTL

pRNA-U6.1/Neo/CTL

Cat. No.	Size	Price
SD1801-10 ug	10 ug	$ 225.00
Full Name	pRNA-U6.1/Neo/CTL

Description: pRNA-U6.1/Neo/CTL is a general-purpose siRNA negative control vector from GenScript. It is designed for mammalian transfection and uses a U6 promoter for siRNA expression. The sense sequence shows no homology any mouse or rat mRNA sequence in the NCBI RefSeq database. It can also be used as a siRNA vector; the siRNA may be inserted using BamH I and Hind III for siRNA insertion.

Storage Buffer and Concentration: Store at -20°C

Download Protocol: tm0169

Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map:
Polylinker: 78-145
U6 Promoter: 4873-77
SV40 Promoter: 894-1239
Neomycin: 1280-2074
pUC ori: 2788-3428
Ampicillin: 3576-4436

Vector Sequence and Restriction Enzyme Map
PRODUCTINFO:  20051024034655  (PDF)
PROTOCOL:  20050506154231  (PDF)

1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.