|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Controls » Negative Controls » pRNA-U6.1/Neo/CTL
|
pRNA-U6.1/Neo/CTL
| Cat. No. | Size | Price |
|---|---|---|
SD1801-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-U6.1/Neo/CTL | |
Description: pRNA-U6.1/Neo/CTL is a general-purpose siRNA negative control vector from GenScript. It is designed for mammalian transfection and uses a U6 promoter for siRNA expression. The sense sequence shows no homology any mouse or rat mRNA sequence in the NCBI RefSeq database. It can also be used as a siRNA vector; the siRNA may be inserted using BamH I and Hind III for siRNA insertion.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 78-145
U6 Promoter: 4873-77
SV40 Promoter: 894-1239
Neomycin: 1280-2074
pUC ori: 2788-3428
Ampicillin: 3576-4436
Vector Sequence and Restriction Enzyme Map
PRODUCTINFO: 20051024034655 (PDF)
PROTOCOL: 20050506154231 (PDF)
![]() |
|
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |









