|
You are here:
Products » Molecular Biology Products » Vectors » siRNA Controls » Negative Controls » pRNA-H1.1/Neo/CTL
|
pRNA-H1.1/Neo/CTL
| Cat. No. | Size | Price |
|---|---|---|
SD1802-10 ug
| 10 ug | $ 225.00 |
| Full Name | pRNA-H1.1/Neo/CTL | |
Description: pRNA-H1.1/Neo/CTL is a GenScript general-purpose siRNA negative control vector. It is designed for mammalian transfection. It uses an H1 promoter for siRNA expression. The sense sequence shows no homology to any mouse or rat mRNA sequence in the NCBI RefSeq database. It can be used as a negative control and as a siRNA vector. This vector employs BamH I and Hind III for siRNA insertion.

Storage Buffer and Concentration: Store at -20°C
Download Protocol: tm0169
Forward Sequencing Primer:
DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer:
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker: 4700-4767
H1 Promoter: 4600-4699
SV40 Promoter: 647-992
Neomycin: 1033-1827
pUC ori: 2541-3181
Ampicillin: 3329-4189
Vector Sequence and Restriction Enzyme Map
DATASHEET: 20051024034858 (PDF)
PROTOCOL: 20050506154231 (PDF)








