molecular biology services
Cat. No.
Name
Size   
Price
Selected
SD0121
10 μg
$140

pGS-21a


Description
The pGS-21a vector is designed for cloning, high-level expression and convenient purification of proteins fused with both 6xHis and GST. Two 6xHis sequences were introduced into the vector for easy detection and purification of fused proteins. The first 6xHis is fused to GST and the fused tag 6xHis-GST can be cleaved using enterokinase. The second 6xHis can be used for detection and further purification after the cleavage of 6xHis-GST.




Storage
Store at -20°C.


Forward Sequencing Primer
DA0009: T7 (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer
DA0010: T7 Terminator (GCTAGTTATTGCTCAGCGG)

Detailed Map

F1 ori: 1061 - 1516
Polylinker: 834 - 892
Ampicillin: 1648 - 2508

Vector Sequence and Restriction Enzyme Map

Related Products

Example

  • zoom

  • Document

  • Document-MSDS: 1075_20051003104720.PDF (PDF)
  • Document-DATASHEET: SD0121_datasheet.pdf (pdf)
  • Document-COA: 14126_20111114035314.PDF (PDF)
  • Document-COA: 14127_20111114035314.PDF (PDF)
  • Document-COA: 14128_20111114035315.PDF (PDF)
  • Document-COA: 14129_20111114035316.PDF (PDF)
  • Document-COA: 14130_20111114035317.PDF (PDF)
  • Document-COA: 188619-1_COA.pdf (PDF)
  • Document-COA: 227778-1_COA.pdf (PDF)
  • Document-COA: 227823-1_COA.pdf (PDF)
  • Document-COA: 349747-1_COA.pdf (PDF)

  • References

    • Cervantes S, .et alThe multifunctional autophagy pathway in the human malaria parasite, Plasmodium falciparum.Autophagy. 2014 Jan 1;10(1):80-92.
    • DWD Chung, .et alCharacterization Of The Ubiquitylating Components Of The Human Malaria Parasite'S Protein Degradation Pathway.PLoS One.2012 7(8):e43477.

    1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.