Email to GenScript

pGS-21a


Select
Cat. No.
Product Name
Size
Price
Quantity
SD0121 pGS-21a
10 μg
$140.00


Description The pGS-21a vector is designed for cloning, high-level expression and convenient purification of proteins fused with both 6xHis and GST. Two 6xHis sequences were introduced into the vector for easy detection and purification of fused proteins. The first 6xHis is fused to GST and the fused tag 6xHis-GST can be cleaved using enterokinase. The second 6xHis can be used for detection and further purification after the cleavage of 6xHis-GST.

Storage Store at -20°C.
Forward Sequencing Primer DA0009: T7 (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer DA0010: T7 Terminator (GCTAGTTATTGCTCAGCGG)
Detailed Map F1 ori: 1061 - 1516
Polylinker: 834 - 892
Ampicillin: 1648 - 2508

Vector Sequence and Restriction Enzyme Map


PGS-21a

PGS-21a

PGS-21a

PGS-21a


Cervantes S, .et alThe multifunctional autophagy pathway in the human malaria parasite, Plasmodium falciparum.Autophagy. 2014 Jan 1;10(1):80-92.

You can visit "Citations Database" for more citations. DWD Chung, .et alCharacterization Of The Ubiquitylating Components Of The Human Malaria Parasite'S Protein Degradation Pathway.PLoS One.2012 7(8):e43477.

You can visit "Citations Database" for more citations.




For more documents, please visit "Technical Support".