pDream2.1/MCS - GenScript

You are here: Products » Molecular Biology Products » Vectors » Expression Vectors » Vector : pDream2.1/MCS

Other vector | siRNA Expression Vector | siRNA positive control | siRNA cassette control | siRNA negative control GenScript pDream2.1/MCS is an excellent expression vector. There are seven restriction enzyme sites in MCS. The gene cloned into MCS can be expressed in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.

Storage Buffer and Concentration:-20°C

Forward Sequencing Primer:
DA0009: T7 (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer:
DA0008: SP6 (TACGATTTAGGTGACACTATAG)

Detailed Map:

T7: 1615 - 1631
P10 Promoter: 1657 - 1770
ORF603: 45 - 1011
ORF1629: 4921 - 5427
CMV Promoter: 1026 - 1608
SV40 Promoter: 3000 - 3345
Neomycin: 3386 - 4180
pUC ori: 5605 - 6236
Ampicillin: 6237 - 7097
MCS: 1837 - 1875

Vector Sequence and Restriction Enzyme Map

Document:

zoom
PRODUCTINFO: 20080314220418 (PDF)


1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.