
GenScript pDream2.1/MCS is an excellent expression vector. There are seven restriction enzyme sites in MCS. The gene cloned into MCS can be expressed in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells.

Storage-20°C
Forward Sequencing Primer
DA0009: T7 (TAATACGACTCACTATAGGG)
Reverse Sequencing Primer
DA0008: SP6 (TACGATTTAGGTGACACTATAG)
Detailed Map
T7: 1615 - 1631
P10 Promoter: 1657 - 1770
ORF603: 45 - 1011
ORF1629: 4921 - 5427
CMV Promoter: 1026 - 1608
SV40 Promoter: 3000 - 3345
Neomycin: 3386 - 4180
pUC ori: 5605 - 6236
Ampicillin: 6237 - 7097
MCS: 1837 - 1875
Vector Sequence and Restriction Enzyme Map
Example
zoom
Document
PRODUCTINFO: 20080314220418 (PDF)
MSDS: 20100805210220 (PDF)
 |
1 |
Gene Synthesis: Custom gene synthesis service starts at as LOW as $0.35/bp, with advanced OptimumGeneTM codon optimization technology and CloneEZ® seamless cloning technology. (starting from $0.29/bp for non-codon optimized human, mouse and rat gene sequences) |
2 |
PCR Cloning and Subcloning: Order GenScript's flexible PCR cloning and subcloning service RIGHT NOW to get fully validated clones delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: Special mutagenesis bundle starts at $149/mutation. Site-directed Mutagenesis services include point mutations, deletions, and insertions for unparalleled accuracy, unlimited sites and comprehensive, fully validated deliverables. |
4 |
Plasmid DNA Preparation: Endotoxin FREE plasmid DNA preparation services deliver predominantly supercoiling plasmid DNA ranging from 100 ug to 1000 mg starting from $45. |
|