|
||||||||||
 *This product has been discontinued! *
pRNA-U6.1/NeoDescriptionpRNA-U6.1/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line. It uses a U6 promoter for siRNA expression. StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 78 - 101U6 Promoter: 4829 - 77 SV40 Promoter: 850 - 1195 Neomycin: 1236 - 2030 pUC ori: 2744 - 3384 Ampicillin: 3532 - 4392 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||
- Home
- Services
- Products
- Nucleic Acid Purification & Analysis
- PCR and Cloning
- Recombinant Proteins
- Proteins, Expression, Isolation and Analysis
- Antibodies
- Peptides & Biochemicals
- Cellular Analysis
- New Products
- Resources
- Promotions
- Special Promotions
- Service Promotions
- Peptide Promotion: Peptide Standard Synthesis 25% OFF till (07/31/2013).
- Friday Promotion: Gene Synthesis 20% off, $0.28/bp till (07/31/2013).
- PolyExpress™ Guaranteed Antibody Package: Get your pAb in 45 Days, starting from $499.
- MonoExpress™ Western Guaranteed Antibody Package: Get your mAb in 45 Days, starting from $3,800 (till 03/31/2013).
- BacPower™ Guaranteed Package: 3 mg purified protein starting from $2,200 till (06/30/2013).
- Guaranteed Antibody Package: 50 mg purified antibody starting from only $8,499 till (06/30/2013).
- Product Promotions
- Company
© 2002-2013 GenScript USA Inc. All rights reserved.