You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-H1.1/Shuttle
|
||||||||||
 pRNA-H1.1/ShuttleDescriptionpRNA-H1.1/Shuttle is a GenScript adenoviral siRNA shuttle vector. It is compatible with Clontech Adeno-XTM Expression System 1. It uses H1 promoter for siRNA expression. StorageStore at -20°CDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4753 - 4776H1 Promoter: 4653 - 4752 SV40 Promoter: 674 - 1019 Neomycin: 1060 - 1854 pUC ori: 2568 - 3208 Ampicillin: 3356 - 4216 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||
- Home
- Services
- Products
- Nucleic Acid Purification & Analysis
- PCR and Cloning
- Recombinant Proteins
- Proteins, Expression, Isolation and Analysis
- Antibodies
- Peptides & Biochemicals
- Cellular Analysis
- New Products
- Resources
- Promotions
- Special Promotions
- Service Promotions
- Hot Summer Special 25%OFF for Peptide Synthesis Service
- MonoExpressTM Western Guaranteed Antibody Package Promotion: Get your Western Guaranteed mAb in 45 days, starting from $3,800 (till 06/30/2012)
- One FREE GPCR Assay for you! till 06/30/2012
- Don't Miss Your FREE Cardiac Ion Channel Test! till 06/30/2012
- Guaranteed Antibody Package Promotion: 50 mg purified antibo7,900 for only $7,900 till 06/30/2012
- BacPowerTM Guaranteed Package Promotion: 3 mg purified protein starting from $1,980 till 06/30/2012
- Gene Synthesis as LOW as $0.35/bp (starting from $0.29/bp for non-codon optimized Human, Mouse and Rat genes)
- DNA Sequencing Service launch promotion: 4 free reactions for new sequencing customers. Up to 40% less than your current pricing.
- Antibody Sequencing Services now start from $1500
- Mutagenesis Bundle Surprise $149/mutation
- Special Partnership Promotion for Gene Synthesis
- Product Promotions
- Company
