You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNAT-H1.1/Shuttle
|
||||||||||
![]() pRNAT-H1.1/ShuttleDescriptionpRNAT-H1.1/Shuttle is an adenoviral siRNA shuttle vector. It is compatible with the Clontech Adeno-XTM Expression System 1. It carries a GFP marker (coral GFP, cGFP) under CMV promoter control. This marker can be used to track the transfection efficiency. It uses an H1 promoter for siRNA expression.![]() StorageStore at -20°CDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 6164 - 6187H1 Promoter: 6064 - 6163 CMV Promoter: 37 - 624 cGFP: 641 - 1357 SV40 Promoter: 2085 - 2430 Neomycin: 2471 - 3265 pUC ori: 3979 - 4619 Ampicillin: 4767 - 5627 Vector Sequence and Restriction Enzyme Map Limited Use Label LicenseThe use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546. Document
Related Products
|
||||||||||












