|
||||||||||
 pRNAin-H1.2/NeoDescriptionpRNAin-H1.2/Neo is a GenScript inducible siRNA expression vector. The H1.2 promoter is an inducible promoter* containing a tetracycline operator (TetO1). The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site, derepressing the transcription from the H1 promoter.
pRNAin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line. StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4700 - 4770H1 Promoter: 4600 - 4699 SV40 Promoter: 647 - 992 Neomycin: 1033 - 1827 pUC ori: 2541 - 3181 Ampicillin: 3329 - 4189 Vector Sequence and Restriction Enzyme Map Limited Use Label LicenseThis product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product. Document
|
||||||||||
