You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNATin-H1.2/Neo
|
||||||||||
![]() pRNATin-H1.2/NeoDescriptionpRNATin-H1.2/Neo is a GenScript inducible siRNA expression vector. The H1.2 promoter is an engineered inducible promoter* containing a tetracycline operator (TetO1). The Tetracycline operator itself has no effect on expression unless the tetracycline repressor (TetR) is present. In the presence of TetR, the promoter effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site and derepressing the transcription from the H1 promoter.
pRNATin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene, which can be used for establishing stable cell lines, and a GFP (coral GFP) marker under CMV promoter** control to track transfection efficiency.
StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 6122 - 18H1 Promoter: 6022 - 6121 CMV Promoter: 57 - 644 cGFP: 661 - 1380 SV40 Promoter: 2069 - 2414 Neomycin: 2455 - 3249 pUC ori: 3963 - 4603 Ampicillin: 4751 - 5611 Vector Sequence and Restriction Enzyme Map Limited Use Label LicenseThe use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546. Limited Use Label LicenseThis product is covered by United States Patent Applications No. 60/505,677, owned by Genscript Corporation. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product. Document
Related Products
|
||||||||||












