You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNATin-H1.2/Adeno
|
||||||||||
![]() pRNATin-H1.2/AdenoDescriptionGenScript's pRNATin-H1.2/Adeno is an adenoviral siRNA shuttle vector.It is compatible with the Stratagene AdEasy Adenoviral Vector System.It uses an inducible H1 promoter* for siRNA expression.The promoter contains a tetracycline operator (TetO1) which can be used to regulate siRNA expression. The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR, causing the TetR protein to release the TetO1 site, derepressing transcription.
pRNATin-H1.2/Adeno is designed for mammalian transfection. The cGFP marker is under cytomegalovirus (CMV) promoter** control for tracking transfection efficiency.The vector also contains a kanamycin resistance gene for transformant selection. LITR and
RITR regions are available for recombinant viral DNA replication. StorageStore the product at - 20°CDownload Protocoltm0165Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0014: pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC)Detailed MappBR322 origin: 5591 - 6258Kanamycin: 7048 - 7839 Polylinker: 2112 - 2141 H1 Promoter: 2012 - 2111 CMV Promoter: 1947 - 1356 cGFP: 1339 - 622 Vector Sequence and Restriction Enzyme Map Example
Document
Related Products
|
||||||||||













