|
||||||||||
 *This product is under development*
pRNA-CMV3.1/NeoDescriptionHuman cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines, compared with RNA polymerase III based promoters such as U6 and H1. In this vector, CMV promoter drives the expression of siRNA, and SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Hind III sites. siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’)  StorageStore at -20°CDownload Protocoltm0172Forward Sequencing PrimerDA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 584 - 651CMV Promoter: 1 - 583 SV40 Promoter: 1267 - 1612 Neomycin: 1653 - 2447 pUC ori: 3161 - 3801 Ampicillin: 3949 - 4809 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||
- Home
- Services
- Products
- Nucleic Acid Purification & Analysis
- PCR and Cloning
- Recombinant Proteins
- Proteins, Expression, Isolation and Analysis
- Antibodies
- Peptides & Biochemicals
- Cellular Analysis
- New Products
- Resources
- Promotions
- Special Promotions
- Service Promotions
- Peptide Promotion: Peptide Standard Synthesis 25% OFF till (07/31/2013).
- Friday Promotion: Gene Synthesis 20% off, $0.28/bp till (07/31/2013).
- PolyExpress™ Guaranteed Antibody Package: Get your pAb in 45 Days, starting from $499.
- MonoExpress™ Western Guaranteed Antibody Package: Get your mAb in 45 Days, starting from $3,800 (till 03/31/2013).
- BacPower™ Guaranteed Package: 3 mg purified protein starting from $2,200 till (06/30/2013).
- Guaranteed Antibody Package: 50 mg purified antibody starting from only $8,499 till (06/30/2013).
- Product Promotions
- Company
© 2002-2013 GenScript USA Inc. All rights reserved.