You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-CMV3.1/Hygro
|
||||||||||
![]() pRNA-CMV3.1/HygroDescriptionHuman cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines, compared with RNA polymerase III based promoters such as U6 and H1. In this vector, CMV promoter drives the expression of siRNA, and SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Hind III sites. siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5’-TAGAAGGCACAGTCGAGG-3’)![]() ![]() StorageStore at -20°CDownload Protocoltm0172Forward Sequencing PrimerDA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 584 - 651CMV Promoter: 1 - 583 SV40 Promoter: 1267 - 1612 Hygromycin: 1635 - 2654 pUC ori: 3330 - 3970 Ampicillin: 4118 - 4978 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||













